Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YL19FM1
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00009733001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: polyprotein
Accession: gb|AAZ28935.1| Score: 342 E_value: 1e-30
KEGG Definition: Os09g0368000
Accession: osa:4346879 Score: 279 E_value: 1e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P04146|COPIA_DROME

Sequence:
>SY0AAB33YL19FM1
TTGGCATTATTGGTTCCCTAATGTATGTGGCCTTGGGTACTCGTCCGGAT
ATTGCTTTCGCGGTTACCAAGCTTAGTCAATACAACCATGAGCCACATAC
CATCCATCTTACTGCGGCTAAGAGAGTCTTATGCTACTTGAAGTCTACAA
GCACCTACAGTCTTCAGTTTTCTAAGAATGAAAGTTTTGAATTCCAAGGA
CCACATAAGCTTATCGGATATACAGACGCCGATTGGGCAGGAAATCCACA
GGACCAGAAATCAATCAGTGGATCTGTTTTCTTTCTCAGAGCACCTGTGT
CTTGGAAGTCTAAAAGACAGACTATCATCGCGACTTCAACAACCGAAGCT
GAATTTAGTGCTTATCTCAATGCCTCAAAGCAGGCTTTATGGCTATGGCA
ATTCATTGAGGATATTTGCTACCCAAGCTCTCTTTGTCCTAAGATCCCAT
CCAAGCATGAAAATCCGCATAAAAACCAGTCCGACTCTTATTTGGCTTAC
ACCCATGGCTGCATAACTATCTACAGTGATAGTGAGTGGGCTATTGCGAC
TGTCAAAGGCGAAGGGATTACTACACGAAATAAACACTTTGATATCTGCC
TCCTAAAGTCTCGTGAGCTTCAGTAGCATG

Sequences in the Contig:

SY0AAB33YL19FM1