Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YJ07FM1
Length(NT) : 570
Best Gene Model Blast : Link to GSTUMT00010967001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 333 E_value: 9e-30
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 283 E_value: 3e-24
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 232 E_value: 2e-20
PFAM Definition: No Hit Found
Swissprot: Q99NH0|ANR17_MOUSE
Gene Ontology:
GO:0007492 = Biological process: endoderm development

Sequence:
>SY0AAB33YJ07FM1
TTGGGATGTCAACCCCAACACTCCCGACACCAAATCCGGTCAAACCCCAC
TCTGGTTGGCTGCGAGAGGTGCGCATGTGGGAGTAATAAAGTTACTATTG
AAAAGAAAGGACATCGATCTCAACACTGCAGACTACCAATCTGGTCAAAC
ACCGCTCTTGGTAGCCGTGGAAGGCGGACATGAGGGGGTAGTTAAGTTGC
TATTGGAACGAGAGGATATCAATCACAACATCACAGGTACCAAATACCGT
CGAACGCCACTCTGGTGGGCTGCGAGAGGTGGAAATGCGGGGGTAATAAA
GTTACTATTGAAGCGAGAGGGTATCGATCCTAATACGGCGGATACCCTAT
CTGGACAAACACCGCTCTCGGTAGCTGCCCAGCACGGACATGAGGAGGTG
GTCAAGTTGCTACTGGAACGAAAGGATATCAACCCCAACCTTGCCGATAC
CATATATGGCGAAGCAGCACTCTCATGGGCTGTGGTGAGTGGGCATGAGG
GAGTAGTCAAGTTGCTGTTGGAACGAAAGGATATCAATCCCAACACTAAA
GGCGCCCAATATGGTCTCAC

Sequences in the Contig:

SY0AAB33YJ07FM1