Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YH09FM1
Length(NT) : 611
Best Gene Model Blast : Link to GSTUMT00009960001 E-value : 1e-127
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001537674.1| Score: 190 E_value: 4e-13
KEGG Definition: hypothetical protein
Accession: ang:An04g04040 Score: 173 E_value: 2e-11
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0907 Score: 154 E_value: 2e-11
PFAM Definition: Thioredoxin, Thioredoxin. Thioredoxins are small enzymes that participate in redox reactions, via the reversible oxidation of an active centre disulfide bond. Some members with only the active site are not separated from the noise..
Pfam Number: pfam00085 Score: 178 E_value: 3e-14
Swissprot: Q9UW02|THIO_COPCM

Sequence:
>SY0AAB33YH09FM1
TTGGATTGCACCCATGGCAAACGTCAGCATCATAACGTCTCCAGAACAGT
TCGAAGAGCTCAAGAAGACCTCCACTCTCCTCATTATCGATTTTCATGCC
ATCTGGTGTGCCCCATGTAAAATCGTCAACCCGGTCTTCATGAAGCTAGC
CGAGAAGTTTGCGTCTCCCGGAAAAATAGTCTTCGCAAAGTGTGATGTCG
ATGACAACCAACAGATATCCAAGGACCTTGATGTTACAGTGTAGGTAGCA
CACCGAACGAGCCGTGTTCGCTTTTTTGTTTCTTTTCCTTCTCCCCGGGT
CCAGTATTGCCAGGCGCGGGGGGGGCTTTGCTTTTTTGGGATGGAAATGA
TGGGGGCTAACTCGAACTCATTTTACTCTGCAGGATGCCATCCTTCCTTG
TGTTCAACAATGGAGCCCTGGTGGAGCGTGTCCAGGGCGCCAGGCCCATG
GTTCTCAGGACTACTCTTACCAAATTGGTGGAGGGGGTTCAAGCCTCTGA
TTCTGGATCCTCTTCGGCTGCCGAAGGGCTTACCGCATCCGAAACAAAAC
CTACCGCTACTAGCTCCACCTCCGCTGCCACTGCCTCCACTGCTGCTGGC
ACCACTTCTAC

Sequences in the Contig:

SY0AAB33YH09FM1