Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YG20FM1
Length(NT) : 537
Best Gene Model Blast : Link to GSTUMT00011967001 E-value : 2e-67
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001540233.1| Score: 148 E_value: 2e-08
KEGG Definition: hypothetical protein
Accession: ani:AN8290.2 Score: 130 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB33YG20FM1
TTGGATCATACTGTGTGCCTCTTTCGTCTGATAATCGATCGTATCCTTTC
TCACGCTTGCTAATTAGATCACCAACTACCACCCACCTCACATTTCCGTC
ATGGTATATTCCTCTTCACAGCTTGATCCTCCGAGGAGGGGGGGGGGAAA
CTAACGACCGAGGGAAAAAAACAACAGGCACAAACACCCCAACAGCGCAA
AGCGAATGAAAAGTTCGCCAAACGTGAAGAGGCCAAGCGCGGCAAGCCCG
AGAAGTCGGTCAAGAAGCAAAAGTTCAAGTCGCCGATTTCGCAGGGTTGG
TTGAGTATGTCCCACTTCCTTTCTTTCCTTCTTTCCTGTCCGCTGCAGCA
CTTCGGTCGGGTTGCTAATAGGTTATGTGATAATTCATTGTACTAGTCGT
TATCGGGTTCGCTGTTTTCGGAGGTATCGTTTTTGAGCTTATTCGGATGT
TCTTTTGAGGTGGGATTGGGATTGAGAGTTTGGAAGGGGAAGGAAGGGGG
GAGGCAGCGGTTGAAAAGGATTTTTAACTTATCATCC

Sequences in the Contig:

SY0AAB33YG20FM1