Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YG11FM1
Length(NT) : 567
Best Gene Model Blast : Link to GSTUMT00007792001 E-value : 1e-146
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_13345
Accession: ref|XP_001585828.1| Score: 257 E_value: 6e-21
KEGG Definition: hypothetical protein; K07195 exocyst complex component 7
Accession: ani:AN6210.2 Score: 240 E_value: 3e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q6MFS1|EXO70_NEUCR
Gene Ontology:
GO:0005935 = Cellular component: cellular bud neck

Sequence:
>SY0AAB33YG11FM1
TTGGCCAAGCTCCCCCACATTAATTGACAGGGGGAAAAGGAGTTCATCAT
TACCGTCATGAATGGTCTTCGCATGGACGAGCTTTCCGCTGAGGTCGAGG
TCTTGGAATCGAAGCTATCCAAGACTGCAGACCTCTCCACCAAGATCGCC
CTAAGCTTGAAAAAATTATCAGCAAGTGCACAGAATGTCGAACAGGCAGT
TAAACCTATATACAACAAGACGCAGTCGTTAACAGTCCTTTCCGGGAGTA
AGGGAATCCGCTCACCTCAAAATGTGACTGGGGAGAGTTAAGCTTTGTGG
GTTACAGATATCGATGAAGCAATATCGGCAATAGATAGGGTGCGCCAACC
TACAGACGCAGTATCGAAAGAGGAGGGCACAATTCGTCAAGGGCCTTCCA
AGACCGGCCTAACTGAATACCTCGCCTCGCTAAGACGGATCAATGAGGCT
CTATCGAGTCTGAAGAAATCGAACTTACGAAGCTCTCAGAAAGCCGTTAC
TCAAATGACGGGCCTTTTGAAAGCGGGGAGCCTACAACTCGAAGACCTAT
TTAGACAAGCATTAGCC

Sequences in the Contig:

SY0AAB33YG11FM1