Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YG09FM1
Length(NT) : 419
Best Gene Model Blast : Link to GSTUMT00010653001 E-value : 1e-120
Numbers of ESTs : 1

Blast Results:

Nr Definition: DNA-directed RNA polymerases N/8 kDa subunit superfamily
Accession: ref|XP_001262893.1| Score: 332 E_value: 8e-30
KEGG Definition: DNA-directed RNA polymerases N/8 kDa subunit superfamily [EC:2.7.7.6]; K03007 DNA-directed RNA Polymerase II subunit L
Accession: afm:AFUA_7G02620 Score: 310 E_value: 1e-27
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3497 Score: 297 E_value: 2e-28
PFAM Definition: RNA_pol_N, RNA polymerases N / 8 kDa subunit..
Pfam Number: pfam01194 Score: 240 E_value: 1e-21
Swissprot: P22139|RPAB5_YEAST
Gene Ontology:
GO:0005736 = Cellular component: DNA-directed RNA polymerase I complex
GO:0005665 = Cellular component: DNA-directed RNA polymerase II, core complex
GO:0005666 = Cellular component: DNA-directed RNA polymerase III complex
GO:0003899 = Molecular function: DNA-directed RNA polymerase activity
GO:0005515 = Molecular function: protein binding
GO:0006366 = Biological process: transcription from RNA polymerase II promoter

Sequence:
>SY0AAB33YG09FM1
TTGGATCCCGATTCGCTGTTTCTCATGTGGTAAGGTTGTCGGTGATCTCT
GGGAGCGGTACCTCAAGCTTCTTGAAGATGGTGTTGCGGAAGGTGATGCT
ATGGACCAACTTGGGTGCAAGCGCTACTGCTGTAGGAGAATGTTGATGAC
TCACGTAGACCTCATTGAGAAGCTCTTGCGATACAACCCACAGGAGCGCA
CCAGGATCGGCCGTGGTTAGATTTTCGCTCCCTCCCGAAATTTTGCTCGA
GCATAGTCCCTTCATTTCTGCTCGCGCTCTCGCATGCCAACTACTACGAT
CATCGCTTGTTAGATGCCCCCTGTCACCCCCCACGCTGCCCGAGGATGGA
AAGGGTTGCAGTAATTAGAGCAGAAGGGCGCAAATGTACATTAGGCGAAA
TTTGAGATTTTCTATTTCG

Sequences in the Contig:

SY0AAB33YG09FM1