Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YF06FM1
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00006378001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: 3-isopropylmalate dehydrogenase Leu2A
Accession: ref|XP_752944.1| Score: 820 E_value: 4e-86
KEGG Definition: 3-isopropylmalate dehydrogenase Leu2A [EC:1.1.1.85]; K00052 3-isopropylmalate dehydrogenase
Accession: afm:AFUA_1G15780 Score: 820 E_value: 2e-86
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0786 Score: 804 E_value: 8e-87
PFAM Definition: Iso_dh, Isocitrate/isopropylmalate dehydrogenase..
Pfam Number: pfam00180 Score: 721 E_value: 3e-77
Swissprot: Q9Y897|LEU3_MYCGR

Sequence:
>SY0AAB33YF06FM1
TTGGTCCGCAAGGAAATGCAAGCATTTGGAAACCTCCGACCCTGCAACTT
CGCCGCAGAGGCCCTTGTCAAACTCTCACCGCTGAAGGAAGAAGTCTGCC
GTGGCGTCGACTTCAACATCATCCGTGAGCTCACTGGGGGGATCTACTTC
GGTGACAGGAAGGAAGACGAGGGTGATGGAATAGCCTACGACACCGAGCC
TTACTCTCGTCCCGAGATTGAGCGTATTGTCCGTTTGGCGGCACACCTGG
CCTTAAAGGCCGACCCTCCGTTGCCAATCACCTCGTTGGACAAAGCGAAT
GTTCTGGCTACCAGTAGGCTCTGGAGAAAGACCGTCGATGAGGTCCTTGG
CGGGGAGTACCCGCAGATTAAGTACCAACACCAGTTGATCGATTCGGCGG
CCATGATGATGGTTAAAAACCCCCGTTCTCTGAACGGAATCATTGTTACC
AGCAATCTTTTCGGAGATATCATCAGCGACGAGGCGAGTGTGATTCCCGG
TAGTTTGGGGCTCTTGCCAAGCGCTAGTTTGTCCGGTATCCCTGATGGGA
AGACAAAGGTGAACGGGATTTACGAGCCTATTCACGGGTCTGCTCCTGAC
ATTTCCGGAAAGGGAATTGTTAACCCTGTGGCTGCTAT

Sequences in the Contig:

SY0AAB33YF06FM1