Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YD17FM1
Length(NT) : 567
Best Gene Model Blast : Link to GSTUMT00003096001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_07403
Accession: ref|XP_001591956.1| Score: 169 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: spo:SPBC543.08 Score: 153 E_value: 4e-09
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG3750 Score: 247 E_value: 3e-22
PFAM Definition: No Hit Found

Sequence:
>SY0AAB33YD17FM1
TTGGCATCTCCTCCTTCGTACGCATGGGGTCGGTGTCAACCAGCTGACAT
TCACCCCCCGTGAACCAAAACAGTAGATGGGCCCTGTTCAGATGGTCTTC
AGCAGCGCTGCCTGTAAGGTTGCGGGTGGGAAGTGGAGCGGTGGTCATGA
TCTTAGTGGTCATGCATTTCTGCTTACTCATGCTAGCTTGTTTTTGTGGA
GTGAGTTGAGCTGCTCGGGAGTTGCTGGGTGGGAAAGCGCAGGGGTTTTG
GCACTACTGGTAATGTGGTGGTGGATGCTGTTGATGACGGGCATATATTT
CCACACATGGCTAGAGAAGATAACTGGCTGGATCGCCGCAATGTTATATG
CGTGGGCACTGAGGTCGTACCCCACTGTCTGGAGCACTCTTGGAGTTCCG
GGTGTCTAATTTTGTTTGCCTGCTGTGGTTAATGGTTTTGCTGTTGATGG
TGGTTACGGAAGGGTAGACAAAGCACTTTTCAGTTATTAATGCGCCTTTT
ATTTGTTTGTTTTTTTCATTGTTTTTTTTCTTCTTCACTGGTGTATCTTT
GTGTTTCTAATTATGTA

Sequences in the Contig:

SY0AAB33YD17FM1