Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YC05FM1
Length(NT) : 685
Best Gene Model Blast : Link to GSTUMT00007818001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 500 E_value: 6e-49
KEGG Definition: tetratricopeptide TPR_2 repeat protein
Accession: hau:Haur_5149 Score: 417 E_value: 1e-39
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 306 E_value: 5e-29
PFAM Definition: No Hit Found
Swissprot: Q9DBS5|KLC4_MOUSE

Sequence:
>SY0AAB33YC05FM1
TTGGGAACGTTCTTGGACCACGCCACCCAGACGTCCTACAAGGTGTTTTC
CGACTAGCTGTGACACTTCTTGCTGAGAGAAAGTATGAAGAAGCTCAGAT
CATGTATCAACAGGGCCTAAGGGCTATGGAACAGGCTTCGAGACAAGGTC
ACCCAGATGTCCTCGACAGTATTAATATGCTCGGCGAAACACTCCTTGAT
CTCGAAAGGTATGACGAAGCGGAGGCTATTTGTCGACGTGCATTGGCGGG
TAGAGAGAAAGCCCTAGGAGTAGATAACCCATCCACCCTTACCAGTGCCG
ATAACCTTGGTCGAACACTGTATCACCAGAAAAAGTACGAAGAAGCGGAG
AGGATGTTTCAATCTACTCAGGCGGGCAGAAAAAAATTGTTTGGCATATA
CCATCCGGATACCCTAATGAGCTCCCTTCGCCTAGGTGTGACGCTTCTTG
GTAGGAAAAAGTATGAAGATGCTGAGATCATTTATCGACATGCCCTAGGG
GTTATGGAGAATGCCTTGGGGCCCGATCATCCGGAGGTCCTCGAGAGCAT
GAATACGTTGGGCGAGACGCTTCTCGATCTGAAAAAGTATAGCGAAGCGG
AAGCTATCTGTCGGCGTGCGCTGGTGGGTAGAGAGAAGACACTCGGACTA
GATCATCGAGATACCCTACTAAGTGTCAATAATCT

Sequences in the Contig:

SY0AAB33YC05FM1