Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YM13FM1
Length(NT) : 520
Best Gene Model Blast : Link to GSTUMT00005114001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: chromosome segregation protein Cse1, putative
Accession: ref|XP_001270127.1| Score: 475 E_value: 2e-46
KEGG Definition: chromosome segregation protein Cse1, putative
Accession: afm:AFUA_6G04010 Score: 468 E_value: 8e-46
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1992 Score: 401 E_value: 3e-40
PFAM Definition: Cse1, Cse1. This domain is present in Cse1 nuclear export receptor proteins. Cse1 mediates the nuclear export of importin alpha. This domain contains HEAT repeats..
Pfam Number: pfam08506 Score: 217 E_value: 7e-19
Swissprot: P33307|CSE1_YEAST
Gene Ontology:
GO:0005635 = Cellular component: nuclear envelope
GO:0008262 = Molecular function: importin-alpha export receptor activity
GO:0006611 = Biological process: protein export from nucleus

Sequence:
>SY0AAB32YM13FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCAGCGGATCTTATCGCT
CCTTTTGAGGATGTCCAGCCGATTCTGAAGGTTGATGCAATAAAGTATCT
CTACACCTTCCGCAGCCAATTGACTAAGTCACAACTTTCCGATGCTTTCC
CTCTTCTCGCTAGGCACCTCGGATCTCCGAATTATGTTGTTTACACCTAT
ACTGCGATTACTGTTGAGCGCTTGCTGGCGATGGCTTCTGATGGGGAGCC
ATTATTTCACCCCGAAGACTTGAGGCCTTACGCAAAGGACCTTTTTGAGA
ATCTCTTTAGGCTGATCGAGCAAGGCGTTACCCCCGAGAAGATTCAGGAG
AATGAATATCTAATGCGCTGTGTAATGCGGGTTATTATTGTTTCTAGGGA
TGCTACTGGACCGTTGGTGGAATACGTTCTGGGAGGGCTTATCAAAATAA
CAGGTGTAGTCATCAAGAATCCCAGTAACCCGAGGTTTATTCACTATCAC
TTTGAGAGTCTTGGTGGAAT

Sequences in the Contig:

SY0AAB32YM13FM1