Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YM06FM1
Length(NT) : 561
Best Gene Model Blast : Link to GSTUMT00006479001 E-value : 1e-133
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001266020.1| Score: 229 E_value: 1e-17
KEGG Definition: predicted protein
Accession: pic:PICST_56118 Score: 215 E_value: 2e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P0C5R9|YP17B_YEAST

Sequence:
>SY0AAB32YM06FM1
TTGGTCGAACCAGCGGTACCGATACTGGGGAGCGAATACCAACAACCCAA
CATTCCACCACTCGCCACCCCCAAGACCCTACAACCATGAAGCCAATGTT
CTCCCTGTACGTCATTCCCTCTCCTTTCCACCTCGTGCCCATTCGTTCCA
AAATCCCCAACCATTTAACTAACCAAACCATCACAGCTTCAACGTCTGGT
CATGCATCGTAACCTCCGCCCTCGGGATCGTCATATTAAGTGTTCTCGGC
GCGCTCTTTAGATCCGGGCACGAAACAATGGTCGGATCAACCGGGGATCC
GGAGGACGGGGAGAAAGTTGCCGGAATCCTGTTTGGAGCTGTCATGGTTT
ATGCTGGGTTTTTGGTGTTTTGTTCTGGACAGGCGTGGTTGCACAGTCGG
GAGAGGCGGGTGCAGTTGCAGTAGATGGGTGGGGAGAGATGTTTTGGAGG
GGTAAAGGGGGGTTAATTATTGAGATCGTGATGGTATGATATTGGGTATC
CGCTTTTTCCTCTCCTTTTTTCCTGTTTTGTTGCTGTTTGAATATATTAT
ATTATTATTTT

Sequences in the Contig:

SY0AAB32YM06FM1