Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YI21FM1
Length(NT) : 610
Best Gene Model Blast : Link to GSTUMT00002171001 E-value : 1e-155
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein HCAG_05973
Accession: ref|XP_001538368.1| Score: 292 E_value: 4e-29
KEGG Definition: hypothetical protein
Accession: ang:An02g02240 Score: 283 E_value: 1e-27
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1601 Score: 118 E_value: 3e-07
PFAM Definition: GATA, GATA zinc finger. This domain uses four cysteine residues to coordinate a zinc ion. This domain binds to DNA. Two GATA zinc fingers are found in the GATA transcription factors. However there are several proteins which only contains a single copy of the domain..
Pfam Number: pfam00320 Score: 145 E_value: 2e-10
Swissprot: Q9HEV5|ASD4_NEUCR

Sequence:
>SY0AAB32YI21FM1
TTGGCACCTGCTCTGCTTCTACAAAGCAGGCCTCGGTGCTAGAATAATCA
TAAGCTGGCTCCCACGGCTCTTTTCTATTCTCCTGCTCCGGAGCGGCTCC
CATCTCCACATCATCTTCTTCATCCCACATCTGGCAGTGACGAAACAATC
CTTCCTTCCATCTCACGGACTCCATCTAGATCCCCATTGCCATCTCTCAA
CAACACGCTGGCTTCCGTCGCTCTCCCGTCTCCCCCGTTGCGGATTAACG
GGGGTTTTCCAATGACTTTCGCAACTTCATCACCAGGGGCGAGTACTGCT
GGCCAGGGGACTACTCCTGTATGTGTTTTCTTCTGCTTTTTTCATACCCT
GTTGACACGCGACTTTTTTTTCTCCCCTCCTAATTTTTTTCTTCGCTTAT
CGCGTATGTCCTAACACAATGTAATAGCCCATCTGTCAAAATTGCACAAC
GTCAACAACTCCATTATGGCGACGGGATGAAAGTGGATCAGTTCTCTGTA
ATGCATGCGGTCTATTCCTCAAGCTTCACGGCAAGGCACGACCCATTAGC
TTGAAGACGGATGTTATCAAAAGTCGAAACCGTGTGAAGAATTCCGGTCA
GCCGGCCAAG

Sequences in the Contig:

SY0AAB32YI21FM1