Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YI07FM1
Length(NT) : 608
Best Gene Model Blast : Link to GSTUMT00008041001 E-value : 1e-161
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: hypothetical protein
Accession: ang:An03g00250 Score: 124 E_value: 1e-05
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4157 Score: 107 E_value: 6e-06
PFAM Definition: WSC, WSC domain. This domain may be involved in carbohydrate binding..
Pfam Number: pfam01822 Score: 145 E_value: 2e-10

Sequence:
>SY0AAB32YI07FM1
TTGGTCACCTCCCCCTCCCCGCAACGACTCTTATAATCCTTCGAAAAGAA
AAATAATAATAGTAATAATGAAGATTCTCATCCTCGCCGCAACCCTCCTC
CCCTTTCTCACTTCGGTCGCTGCTCAAGCTCCCCGCTATGCCGGTTGCTA
CCGCACGGCGGGCGGCCTCATCCGGGTGGATTCACAGCGCCCCAGCTGTG
CCGAGGCTTGCACTGACGCTGGCAACGCGCCCATCGGAGCGCTGACCAGG
ACCAATGAATGCTACTGCGGTACCACTCCGCCACGCGACGAAGATCGAGC
CCCGGATGCCTCGTGTGATTCTCCTTGCCCTGGTGCTCCGGAGTTGGCTT
GTACCTCACCCTCATCCCTCTAATCCCTCAGGGTTAATGCTAATAGGGAA
CAACAGGTGGAAGCAATTCCGGACAATTCTTCTCGGTTTACTTCTGGACA
GGAGGTCCTTCACCTTCCTCGGGCGCTAATAACGCGACAGTTTCCTCTAC
TCGCGGTGGGAACAGAACCTCCACTGGTCGTAGCTCTGGGACTCAGACTG
CCACCACTACTGGGGCTACGAAGTCTGGAGGAGCTACCGGTACAGCCTCG
GGAGGATC

Sequences in the Contig:

SY0AAB32YI07FM1