Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YH16FM1
Length(NT) : 615
Best Gene Model Blast : Link to GSTUMT00007141001 E-value : 1e-169
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543452.1| Score: 214 E_value: 7e-16
KEGG Definition: hypothetical protein
Accession: ang:An15g06750 Score: 196 E_value: 5e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB32YH16FM1
TTGGAACATTCCAGGTTGCGAATGATCATGTCTTACAACAACAACAAGAA
TTGTTTCAACGTTGTCAACTGTTTTAATAATAACTTGAATATATCGAATC
CCTCTCCCGTCGCCGATCACCAGCCTGAAATCCTAGAATGGCTATCTCCG
CTTGAGCCTCGTGATGATCACTATGACATACAAATCCTCAGAGCCGATAA
TGTGGGGAGTTGGCTGCTGGGGACTGACGAATTTCGACTCTGGAGGGAGA
CGAGTAGAGAGGGCAACCATGGAAATGCTGCCTTATTTTGCTATGGTGGT
CCGGGAGTGGGCAAGACCTACCTTAGGTATAAGAAAGGATCCGGGAAAAA
ACCTCGAGATGGGAAACCTGACGCCGTTGCTTGTTTCTATTTTGATTTCG
CCGCCCAAAAGGAGCAGACTCCGGCCAATATGCTCGGCTCACTGCTCAAG
CAAATAGTTAGGGGATTGGATAGAATCCCAGAAGACATATTGCAGGCCTT
TAAGGATCAGAAGAAGGTCATCGGTGGTCGGAGACTACGGGTTCCAGAAA
TTGTGAGAATGTTACAGACTGTGACACGCTCACAGCGCACATTTATATGT
GTCGATGCGCTGGAT

Sequences in the Contig:

SY0AAB32YH16FM1