Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YH14FM1
Length(NT) : 555
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: I-PcI endonuclease
Accession: emb|CAB72450.1| Score: 147 E_value: 3e-08
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: GIY-YIG, GIY-YIG catalytic domain. This domain called GIY-YIG is found in the amino terminal region of excinuclease abc subunit c (uvrC), bacteriophage T4 endonucleases segA, segB, segC, segD and segE; it is also found in putative endonucleases encoded by group I introns of fungi and phage. The structure of I-TevI a GIY-YIG endonuclease, reveals a novel alpha/beta-fold with a central three-stranded antiparallel beta-sheet flanked by three helices. The most conserved and putative catalytic residues are located on a shallow, concave surface and include a metal coordination site..
Pfam Number: pfam01541 Score: 121 E_value: 1e-07

Sequence:
>SY0AAB32YH14FM1
TTGGCAAATTGATATTAAATTAGGGTCAAGCCAATTGACGGATCAGCTCT
TATGAGAGAGCCCCGAAGATGGTATGAAGCAATTATATGATACTAAGAAT
GACAAGTTCTGTAGTGCTCAAAATATTAAGATTAAGAAAATTACTAATGA
AATTTAAATAATGAAATTAATAATAGTCTTGGCCCTAATTTGATATGCTA
CAGGATTAGGTTTGTACATTGCTCCTTGTTTACTTTGCGCTATTATCCCA
ATAAAAATTTGTTCTAATGTTGAGGTTGATAAAGCTAAAATTCTGAAAGA
AAATCAAAATAAACTTCTCTGTGATAATAAGGGAAGATCAGGCATTTATA
TGTTCACAAATTTGATCAATGGTAAAAGATATATTGGTTCTACTCAAAAC
CTATCTAAGAGATTATACTTCTATTTCTCTGAATCCAAAATGAATTCTGC
TTTAAACCAAGGTAAGAGTTATATTTGTAGTGCAATTCTCAAGAATGGGC
CTCGGATGCTGGGTTAGCTATAGATATATCCTCCGAATTATGGTGCTTGA
CTATC

Sequences in the Contig:

SY0AAB32YH14FM1