Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YH03FM1
Length(NT) : 351
Best Gene Model Blast : Link to GSTUMT00005038001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59031.1| Score: 137 E_value: 3e-07
KEGG Definition: nucleoside phosphorylase
Accession: aor:AO090023000490 Score: 137 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB32YH03FM1
TTGGCAATCTATGTGATCAAGCGGGGAAGGAGAACATCGTTGTTGCAGGC
TTGTACTGCGACTTCCTTGCTCACCAAGAGCAAACAATTACCAACATAAT
GGGAGCTATATTGAAGCAGCTGACAGGCAGAGGGGATAACCCGAATTACC
TACGGGAGGCATTTCATAAAGCGAAAACGGAATTTGGTGGCAGAGGGCCA
CGACTTCCGGATCTGATGGGAATGCTGGGGATCGCTATTGCTTCGCTACA
CCAAGTTTTCATCTGTATTGATGCGCTAGATGAATGCCCACCGAAGCATC
TGCCAAAGCTGCTGGAGTCGCTGAGAGACATTATTCGGGAGTCCCCCAAC
A

Sequences in the Contig:

SY0AAB32YH03FM1