Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YH02FM1
Length(NT) : 516
Best Gene Model Blast : Link to GSTUMT00009069001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_04919
Accession: ref|XP_359858.1| Score: 361 E_value: 4e-33
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04919 Score: 361 E_value: 2e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB32YH02FM1
TTGGCCCTCTGATTCTCTTCGAAATCATGCATTTACCACATAACAACTCT
GGCATCGTCGCCTTACTCTTAATACTGTTTGTGTCCTTAGCCAAAGCCCT
CGAGAAGCCCGGTACCGGCGAACCTGAGCCGTTGAAGTATACCCCTGGAG
ATCAGATTTCTGTGCAGTGCTTGAATCGGACGATAGATACCGGCGAACAT
GTACAAGATGAGAAGACTGGAGTACTGCAGTATATCCCATTCGCAACATG
CAACGAGACTGGCCGACCACTGGAGGTTAAATTTCTGGAAGACGGAGAGG
TGAATTGTACCATACCTTTCTTGTCGGACGAGATGTTCCACCTTTTCGAA
TTCTACGTGCATCACGATTCGCCACTGGCTTGTCGAGTCCCCGTTCGCCC
ACTGGGAGGTGAACGGGACTTGGAGAAGAAGAGTGATGAGGAGTACGTTC
CTTTAGTCTTCGCCCTTGCCGGCAAACTTGAAACCTCACACATACATCTA
GCAACGAACATGAACG

Sequences in the Contig:

SY0AAB32YH02FM1