Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YG21FM1
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00001750001 E-value : 1e-69
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0657 Score: 166 E_value: 8e-13
PFAM Definition: Gp_dh_N, Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain. GAPDH is a tetrameric NAD-binding enzyme involved in glycolysis and glyconeogenesis. N-terminal domain is a Rossmann NAD(P) binding fold..
Pfam Number: pfam00044 Score: 160 E_value: 4e-12

Sequence:
>SY0AAB32YG21FM1
TTGGCAGCACCCTTCTATTTTCATCAATACTCCGCTATTTCCCCCCAAAC
ATTTTACTCGCTTTACACTCCAGTAAGTACCTCTTGTTTTGCCCTTCTCG
AAGCACCGAGTCATCCAAATCCTCACTCCGATACTTCCTTCCATTTCCCT
GTGATAATTGTTTGCGATAATCCGAATCCCCTTCTGCCTACTACCTCTTC
CTATAGGCTCCGTTCACTTGGTATCGGGAAATTAATAAAATATATAGGGT
TCTCAATTCAAAATGGCCGTCCCCATTGGTATTAAGTAAGTTTCAAAAAT
TTTCACGGTAGATGATTAAGGATGATGCTAATAGTTATTTTTCTAATCCC
AGCGGCTTTGGTCGCATCGGACGTCTTGTATGTTCATCCGTCTAACCTTT
TGATTATCCTCCATCCGTAGATAATTCTTTCACCGGATGAATATTTCTGG
CTTACTTTTGTGGTAAATATCGTAGGTCCTCCGTAATGCCGCCGAACGCG
ACGACGTCAGGGTTGTAGCTGTTAACGATCCCTTCATCGATCCTAAATAT
GCGGTCTACATGTTCAAGTACGATTCCGCTCATGGAAATTTTAAGGGAGA
GGTTAGC

Sequences in the Contig:

SY0AAB32YG21FM1