Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YG10FM1
Length(NT) : 571
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An11g03470
Accession: ref|XP_001394346.1| Score: 173 E_value: 3e-11
KEGG Definition: hypothetical protein
Accession: ang:An11g03470 Score: 173 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P38364|PID6_FUSSO

Sequence:
>SY0AAB32YG10FM1
TTGGTCTCATTATAGGCATGTTTCTTCTAGATCCTTATCGCCAGGCCACC
ATTGCAGCCTGCGCTGCGTTTCTTACCCAACAAGTGCTCTCCCCCATCCC
CGAAGTCTCAACAACGAAATCGATCCTCTTCTACACTATCGCGAATGGCC
TTTTGGTTCTTGCGCTGAAGAGAGCGGGGAACTGTATGTTGCATCTCCTT
ATCCGCGTATCCTTAATTAACATTAGCTATCTCACGAGCTTGGCATTTTT
CACAATCGTACATCGCCTCTACTTCCACCCTCTTAGAAAGTTCCCTGGTA
GTAAAGTTGCGCGCTTGTCAAAGCTATATGAAGCCTGGCTCAATTACAAT
GGCATGAATGGCCGGGTAGTGCGGGATCTATGTCGGAAACACGGAGACTT
TATACGAACCGGGCCCAATGAACTTGCTATCAACAATGTCGAAGCGGTAG
AAATTATCTGGGGGAGGACTCAGCCTACGTCCAGAGGCCCTTTCTGTGAG
TTTGCAAACTTTATAGGGGAAAGGCACTTAGTTAGCCAGAGAGATAAAGC
CATACACGCTTCCTGGAGACG

Sequences in the Contig:

SY0AAB32YG10FM1