Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YE16FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00010225001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_09433
Accession: ref|XP_001239812.1| Score: 380 E_value: 5e-35
KEGG Definition: soluble epoxide hydrolase
Accession: aor:AO090102000130 Score: 365 E_value: 1e-33
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG4178 Score: 173 E_value: 1e-13
PFAM Definition: No Hit Found
Swissprot: P80299|HYES_RAT
Gene Ontology:
GO:0004301 = Molecular function: epoxide hydrolase activity

Sequence:
>SY0AAB32YE16FM1
TTGGACCTCTACAACAGCGAGATAGTATCTCATATCGCCAACGTTTGTAC
ACCTTTTGCATCCCCAATGCGAGAATACATCCCCATTCGTGAGCTGGTAG
CAACAAAAATCCCCTCGTTCAAATACCAAATAGCGTTTCAGGACCCACAG
ACAGAGAAGGATACCGAAGCACCCGGCAAGATTCGGCAGTTCCTTAAGGG
GTTGCACAGAGGTCTTGGAGATGAGCGGGGCAATTTCATGGTGGATAAGG
ATATCGTCGAGAGTGTTGGAGATCTCAAGAGGAGCAAGTTCATGACCGAG
GAGGATTTGCACTACTTTACGAAGGAATTCGAGAGGAATGGGTTCCACGG
GCCTCTGAACTGGTATAAGGCTGGGAAGGTGAACTATGAGGATGAGAAAG
ATCTTCAGTTTGATGGGGTCAAGGTGCCGTACCTTTTCATCGGAGCGAGA
CATGACGTGGCTCTTCCGCCTTCTATGGCCGAACCTCAGAAGCGGTTTAT
CTCACAGCTTACCGTCCGGGTTGTGGAGACTGCCCACTGGGCTATGGTGG
AGGATCCGGAGGCCGTTATTGGACACATGAGCGAGTGGTTGGATACTGTT
GTTCTTGGTGGCAAGAGCACGCTCTGAAGATATTGTGCTGTGA

Sequences in the Contig:

SY0AAB32YE16FM1