Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YD20FM1
Length(NT) : 542
Best Gene Model Blast : Link to GSTUMT00006128001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_09225
Accession: ref|XP_001799524.1| Score: 286 E_value: 2e-24
KEGG Definition: hypothetical protein
Accession: ang:An17g02140 Score: 279 E_value: 8e-24
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Posttranslational modification, protein turnover, chaperones, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1444 Score: 280 E_value: 4e-26
PFAM Definition: No Hit Found
Swissprot: P40107|GOG5_YEAST
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0005739 = Cellular component: mitochondrion
GO:0005338 = Molecular function: nucleotide-sugar transmembrane transporter activity
GO:0005515 = Molecular function: protein binding
GO:0030259 = Biological process: lipid glycosylation
GO:0015780 = Biological process: nucleotide-sugar transport
GO:0006487 = Biological process: protein amino acid N-linked glycosylation

Sequence:
>SY0AAB32YD20FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGCTTTAGTTCTTCTCCGTTTTTTTGTTTGGGATCTTGGCCTCT
TGTCTTTACCAACTTCAGCAGTTGTCAACGACAACCACCTTCGACTATAA
TAACGAGATCGTTTTAGCCACCTAGGTTACAAAGCATTTACGGTGATGGC
CGAAAAAGAGAAACAGGAGGCTTTCCGCGTCGATATTCCTAGTAATGATA
AGGGATTTGCTCCTCCTTCGCCGCGTGGACCTCCCCCGGCTCCGGTGGTG
AGCAATCCGTTGTTTCCAATCCTCAGTTACTGCGGAGCCAGTATTCTCAT
GACCGTGACGAATAAATATGTATTGTCGGGATATGACTTTAATTTGAATT
TCTTCTTGTGTATGGTGCAGAGTATTGTTTGTGTGGTTGCCATCGCCATT
GGCAAATCAATGGGTTATATCAAGTATCGGGACTTCAGCATGGATGAAGC
TCGAAAATGGTTTCCCATCTCCGTTCTTCTAATTCTTATGAT

Sequences in the Contig:

SY0AAB32YD20FM1