Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YC19FM1
Length(NT) : 549
Best Gene Model Blast : Link to GSTUMT00002669001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: mitochondrial 40S ribosomal protein MRP2
Accession: ref|XP_001560254.1| Score: 308 E_value: 7e-27
KEGG Definition: unnamed protein product; K02954 small subunit ribosomal protein S14
Accession: aor:AO090011000506 Score: 307 E_value: 5e-27
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1741 Score: 264 E_value: 3e-24
PFAM Definition: Ribosomal_S14, Ribosomal protein S14p/S29e. This family includes both ribosomal S14 from prokaryotes and S29 from eukaryotes..
Pfam Number: pfam00253 Score: 161 E_value: 3e-12
Swissprot: Q9HF53|RT02_ASHGO

Sequence:
>SY0AAB32YC19FM1
TTGGCCACCACCAAAAAAGAAAAAGAAAAAGAACATGTTTCCAACTCTCC
GTCTGTCAAAAGCCCTCAACCTCGGTAGCTTCGTCAATGCCCGAGTACTC
CGTGATCATGCCAGACGTGAGGCATTCGCAGCGGCTGAGCTGACCCGTCA
AGCGCTCAGATACATCGCGCAGAACACGCAACTCCCACTTCTGCAGCGGA
CAAAGGCACAGGTTGATCTCGCGCTCATGGACTCGAACACTCGAAGGATG
AAGATAAAGAACCGGTGCATCGTGAGTGGGCGCGGGAGGGGTATTTTGAG
GAATTTCCGGATATGTCGGTACCAATTTAGGTTGATGGGCAAGGCCGGTG
ATCTCCCGGGCGTTAAGAAGGCGAATTGGTAGTTCGTGACTCCTCCGCTG
GCGTGGTGGTAGTGGAAATGTGTGGTGGTGGGGCACCACAGAGCTTGTGA
CTGGCTGACCGGCTTTGCCGCTGTACATACATTTCTCGTGTTGATATGAA
CCGTATCGGATGGTGCATCTATTGCCCCCACCTCCGCATTTCTTCTTCC

Sequences in the Contig:

SY0AAB32YC19FM1