Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB32YC05FM1
Length(NT) : 545
Best Gene Model Blast : Link to GSTUMT00000637001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_01745
Accession: ref|XP_363819.2| Score: 489 E_value: 7e-48
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01745 Score: 489 E_value: 4e-48
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport, Cytoskeleton].
Kog Number: KOG0704 Score: 478 E_value: 5e-49
PFAM Definition: ArfGap, Putative GTPase activating protein for Arf. Putative zinc fingers with GTPase activating proteins (GAPs) towards the small GTPase, Arf. The GAP of ARD1 stimulates GTPase hydrolysis for ARD1 but not ARFs..
Pfam Number: pfam01412 Score: 365 E_value: 6e-36
Swissprot: P35197|GCS1_YEAST
Gene Ontology:
GO:0005856 = Cellular component: cytoskeleton
GO:0005768 = Cellular component: endosome
GO:0005793 = Cellular component: ER-Golgi intermediate compartment
GO:0005802 = Cellular component: trans-Golgi network
GO:0003779 = Molecular function: actin binding
GO:0008060 = Molecular function: ARF GTPase activator activity
GO:0042802 = Molecular function: identical protein binding
GO:0030037 = Biological process: actin filament reorganization during cell cycle
GO:0006888 = Biological process: ER to Golgi vesicle-mediated transport
GO:0043001 = Biological process: Golgi to plasma membrane protein transport
GO:0006890 = Biological process: retrograde vesicle-mediated transport, Golgi to ER

Sequence:
>SY0AAB32YC05FM1
TTGGTGCTTCTGTATGATACTCCCTCGCGTGAAGCACCGAGCTTTTTTTC
CCGGGCATTTAACATCTTTATTATTAATTTACGGTTATTGCTTTTTCTCA
AGCCTAAACCTCCAAAATGTCGAAAATGTGGGAGGTTGACCCCGAGACGA
GGAGAAAGCTCCTTGAGATCCAAAAGAGGGATGGGAATAATGTTTGCTGC
GATTGTAATGCTCCTGCCCCTCAGTGGGCCAGCCCGAAGTTCGGGATTTT
CATCTGTTTGACTTGTGCGGGTGTTCACCGAGGTTTAGGTGTTCATATAT
CTTTCGTGCGCTCAATCACAATGGACTCCTTTAAAAATGAGGAGATCAAA
CGTATGGAGAAGGGAGGGAACAAGAGGTGCCAAGAGTTTTTTCAGAAGGC
GCCCGAGTTTGGTGATAATATGACTATTAGCGAGAGGTACGGAAGCTCTT
TTGGTGAGGACTATAAAGAAAAGTTGACGGCAGACGTCGAGGGTCGGGAG
TGGGTACGGAAAGAGCGCCTTAAAGCGTCTCCTTCTCTTGCTTTG

Sequences in the Contig:

SY0AAB32YC05FM1