Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YN18FM1
Length(NT) : 550
Best Gene Model Blast : Link to GSTUMT00005814001 E-value : 2e-80
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU01011
Accession: ref|XP_961623.1| Score: 135 E_value: 8e-07
KEGG Definition: hypothetical protein
Accession: ncr:NCU01011.1 Score: 135 E_value: 4e-07
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3794 Score: 105 E_value: 8e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB31YN18FM1
TTGGCATACCCCACCCAAATACCGCCTTAACTAAAACTACCATACCACAA
AAACCTCTCGCCAGCGATAAAACTACCAAGACCAAGCCGGGAAAAAAGAA
AAAAAAAGAGAAAAAGAAAAAAAAAAAGAAGAAAAAAAAAAGAAATGGCC
TACAACACCCGCTCGAGTGCCCACACCACCCGCTCCAAAACCAAAACTCC
CCACAAAACTACCACCACCCCAACAACCCTGAAGACAAGCCGAATGAAGG
CCCCCAAGTCCGCGCCGACCACGAAAAAAACTCCAAGCCACCGCACGGGC
GCTGGCGTGGCCAAGAAGCCCCGCCACCACAAGCGCAAGCCACGTCTTTC
AGATAAACTTGAGGGCGCGCTATTGAAGGTCGAAGGAACGCTAACTGGGA
GGAGAGGGGTTAAGGCCGCCGGAACCAAAAAACTTCGTGGCACAGACGGA
AAAGGCGAGAGGAGGTCTATTCGGAGGTCGATATAAGCCACCTTTTTTTT
CTTCTCCTTTTTTCGCCTTCCATAATACTGTGGATAAACTTGGGGGGGGG

Sequences in the Contig:

SY0AAB31YN18FM1