Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YN05FM1
Length(NT) : 375
Best Gene Model Blast : Link to GSTUMT00000210001 E-value : 1e-150
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06016
Accession: ref|XP_001593094.1| Score: 297 E_value: 9e-26
KEGG Definition: hypothetical protein
Accession: fgr:FG00929.1 Score: 290 E_value: 3e-25
KOG Definition:
Classification: [Lipid transport and metabolism, Signal transduction mechanisms].
Kog Number: KOG1118 Score: 115 E_value: 2e-07
PFAM Definition: SH3_1, SH3 domain. SH3 (Src homology 3) domains are often indicative of a protein involved in signal transduction related to cytoskeletal organisation. First described in the Src cytoplasmic tyrosine kinase. The structure is a partly opened beta barrel..
Pfam Number: pfam00018 Score: 112 E_value: 6e-07
Swissprot: Q12163|NBP2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0006972 = Biological process: hyperosmotic response
GO:0006469 = Biological process: negative regulation of protein kinase activity
GO:0009408 = Biological process: response to heat

Sequence:
>SY0AAB31YN05FM1
TTGGGCATGGGAAGGCTGTTGCGTTATTCGACTTTATTAGAGAGAACGAG
AATGAGCTTCCATTGGTTGAAGGCCAGGTTGTGTGGGTTAGCTATCGGAT
TGGAGTGGGTTGGCTAGTGGCTGAGGATCCGAAGACTGGCGAATCAGGCC
TGGTCCCAGAAGAATATGTCCGTCTCCTCCGCGATCTGCAACCCCTCTAC
ACCCCACATCCGGAATCAGGATCCCCACCCAATCCCCACCATGATCAAGA
ATCCCCGCTAATATTATCCGGCTCTCCCCAACCTTCGTCCCGGTCCCCCT
CTCCCTCCTCCTCCCCACAGCAACCCCCCTCAACCTCTTCAACCTCGACA
ACCTCAGCAACCTCAACCTCAAACA

Sequences in the Contig:

SY0AAB31YN05FM1