Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YM14FM1
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00001650001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_09001
Accession: ref|XP_001552819.1| Score: 259 E_value: 5e-21
KEGG Definition: hypothetical protein [EC:3.1.1.3]; K01046 triacylglycerol lipase
Accession: ani:AN9106.2 Score: 256 E_value: 6e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB31YM14FM1
TTGGATTTTTTTATCATCAAATTAATAAGAGCTCCGCCAAAAGGCATATA
GCTCGACGGCAGCACATGGGAATCATCACCGAGATGGGTTTGTTGGTACA
AACAAAGATCCCGCAGTGGACCGCCAAACCGCAGCAACTCGGCTCTCTTG
GCAGAATTATCCCCAGGGGACGCGAAAAGGTATTGAAAAACCTAAAGATG
CATGACCCAGGAAGATCACTACTTGGTGAATTCTCAGCTATTCGGAGAAG
ACGCGAAACCCAGGAGTCTGTGCTGCGTGTCAACAGGGCCAAGGAGGGGT
CTAAAGAATTTGCGTCTGATGATCCCCGGGCACGACAGCTAGGCAGGACT
TTATCCGACGGGTTTGCGGTTATCAAGGAGAAATACCGGGCCCCAGATAA
CCCAATTGTTCTGTGCCACGGACTTCTGGGGTTTGACGAGTTAAGGCTTG
CAGGGAATTATCTCCCTGGGATACGCTACTGGCGGGGAGTAACTGAGGCT
TTCAATGCTAATAATATCGAAGTCATTCTTACCAGCGGTTTGGCACCCCT
GACCCAGACTGTTTGGGTGCTTACTGGTGATTGTGGTTTTCCAGTGCCGG
CATCCGGATCCATAGAAGTCAGAGCTAAGGCCCTTGCGGAATGTATTCGG
CTA

Sequences in the Contig:

SY0AAB31YM14FM1