Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YL18FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00006213001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU09063
Accession: ref|XP_958567.2| Score: 792 E_value: 8e-83
KEGG Definition: hypothetical protein
Accession: fgr:FG10944.1 Score: 776 E_value: 3e-81
KOG Definition:
Classification: [Chromatin structure and dynamics, Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0996 Score: 630 E_value: 1e-66
PFAM Definition: SMC_N, RecF/RecN/SMC N terminal domain. This domain is found at the N terminus of SMC proteins. The SMC (structural maintenance of chromosomes) superfamily proteins have ATP-binding domains at the N- and C-termini, and two extended coiled-coil domains separated by a hinge in the middle. The eukaryotic SMC proteins form two kind of heterodimers: the SMC1/SMC3 and the SMC2/SMC4 types. These heterodimers constitute an essential part of higher order complexes, which are involved in chromatin and DNA dynamics. This family also includes the RecF and RecN proteins that are involved in DNA metabolism and recombination..
Pfam Number: pfam02463 Score: 266 E_value: 2e-24
Swissprot: Q12267|SMC4_YEAST
Gene Ontology:
GO:0000799 = Cellular component: nuclear condensin complex
GO:0003682 = Molecular function: chromatin binding
GO:0005515 = Molecular function: protein binding
GO:0007076 = Biological process: mitotic chromosome condensation

Sequence:
>SY0AAB31YL18FM1
TTGGTCCACTTCCAAGAAGTCCTTGATGCGGCTGGCGGTGGGCATGAGGT
GGTTCCAGATTCAAAGTTGGTTGTTTCGCGTCGAGCCTTCAAGAACAACT
CTAGCAAATATTACATCAATGGCGGAACGAGTGATTATACCCAGGTTACG
ACTCTCCTTCGCGGCCGTGGAATCGATCTTGACCACAAGCGATTCCTTAT
TCTCCAGGGCGAAGTTGAGAGTATTGCTCAAATGAAGCCTAAGGCTCAGC
ACGACAGTGACGATGGTTTGCTAGAATATCTAGAAGATATCATCGGCACA
AGTAAATATAAACAACCTATTGAGGAGTCTGCCACCCAAGTCGAGGAACT
TAACGAGATTTGCGTTGAGAAATCTACCAGGGTACAACATGTCGAGAAGG
AAAAAAACAGCCTCGAGGACAAAAAGGAGGCCGCACTTGAGTTCATCCGG
AACGAGAATGAGCTCACAATGAGAAAGTCTGCGCTTTACCAAATTCATAT
TGCGGATAGTACAGCGAACATCAATGTCACCGCAGAGATGACCACTCAAT
TGCAAGCACAACTGGATGAGGAGCTGGAGAAGCATCGGGGCAATCAAGAT
GAGATCAAGAAACTTGAGAGAAAGTACAAGGCCGGCTCTA

Sequences in the Contig:

SY0AAB31YL18FM1