Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YJ24FM1
Length(NT) : 550
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 239 E_value: 6e-28
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 233 E_value: 2e-26
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 186 E_value: 3e-15
PFAM Definition: No Hit Found
Swissprot: Q502K3|ANR52_DANRE

Sequence:
>SY0AAB31YJ24FM1
TTGGCTCGGAAGGGGCGACGTCAGTCCCGACAAACCAGATAGCTCCGGCC
AAACACCACTCTAGCGTGCTGCTCTGAATAGGCATGAAGTAGTAGTGAAA
ATACTACTCGGACGGGCCGACGTCGACCCTAACACATCAGATAAGTGGTG
CCCAACACCACTCCATTGTGCTGCCTTGTATAGGTACGAGGGGGTATGGG
TACGAGGGGGTGGTGGAAATACTACTCGGATGTGGCAATGTCAACCCCAA
CGCACCGGATACCTATTACCGAGCACCGCCCCATTCCGCTGCTTCCAGTG
GGCATGAGGGAGTGGTAAAAATACTACTCGGACGGACCGATGTCGACCCC
AACAGACGAGATAGGTACGGCCAAACACCGCTCTGGTCGGCTCCTAAGGG
TGGCCATGCGGAGGTGGTAAAAATGCTACTCGAACGGCCCGACATTGACC
CCAACAAACCAGATAACCACGGCCGAACACCGCTTTGGTCGGCTTCTAAG
AATGGCCATGTGGGAGTGGTGGCGCTACTACAGTCCCCACCATCTGCCTC

Sequences in the Contig:

SY0AAB31YJ24FM1