Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YJ04FM1
Length(NT) : 720
Best Gene Model Blast : Link to GSTUMT00010923001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_09721
Accession: ref|XP_001240100.1| Score: 571 E_value: 4e-57
KEGG Definition: protein phosphatase 1, regulatory subunit, and related proteins
Accession: aor:AO090023000234 Score: 571 E_value: 2e-57
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0531 Score: 198 E_value: 2e-16
PFAM Definition: No Hit Found
Swissprot: P32336|NUD1_YEAST
Gene Ontology:
GO:0005816 = Cellular component: spindle pole body
GO:0005200 = Molecular function: structural constituent of cytoskeleton
GO:0007020 = Biological process: microtubule nucleation

Sequence:
>SY0AAB31YJ04FM1
TTGGGTATCATTTCATATGACGCCACTGGCAGATATCTCATATCACTATG
AAACCACCGAAGCTCTGATCAATCTCGAACTCTCGTTCCTTGCGACCCGT
AGGGGGCCTAAAGCTAGCGCTAAGTCAATTGAAGCAAGCTTCTCGATTGC
CCAGGAAAACCTCATTAAAACCCTTACAGATGTGGAGCCGTATGAGCCAT
ATTGGGAGTGGATGAAGTTCTTAAAGCTTGCTGATAGGAAGATGGAAACG
CTACATACTCTCAACGAATGGTGCCAGAGAATAGAGGAACTAGACGTTAG
TAATAACCAGCTTGGTCAACTCTCAGGGGTTCCGGAAAACGTAAAGGATC
TAAAGGCGGCGAGTAACTGCTTGAGTTCGATCACCCACTTTGGACATCTT
TTCAATCTGCAGTATTTGGATATTTCGAGAAATGGTCTAGAAAACTTAGA
TGGGCTCAGGAACCTGAAACATCTAAGAGAGCTCAAGGTAGATGAAAACT
CTTTGGAGAGCCTTGAGGGTGTTCTGAATATGGACGGATTGGCGTCGTTG
AGGGCTAGGAGAAATAAGTTGACAACTGTGTCGTTTGAGAAGGCTTCCAT
GAAACGTCTCACCGAGTTGGACTTGAGAGGTAACAACATGGAGGCGATCT
CAGGACTTGACAACCTACCTGCTTTGATTCACCTTAATCTAGATCAAAAT
AAGCTATGTGGTCTGAATAT

Sequences in the Contig:

SY0AAB31YJ04FM1