Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YI13FM1
Length(NT) : 570
Best Gene Model Blast : Link to GSTUMT00008726001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN1511.2
Accession: ref|XP_659115.1| Score: 360 E_value: 7e-33
KEGG Definition: hypothetical protein
Accession: ani:AN1511.2 Score: 360 E_value: 4e-33
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3875 Score: 170 E_value: 3e-13
PFAM Definition: SH3_1, SH3 domain. SH3 (Src homology 3) domains are often indicative of a protein involved in signal transduction related to cytoskeletal organisation. First described in the Src cytoplasmic tyrosine kinase. The structure is a partly opened beta barrel..
Pfam Number: pfam00018 Score: 118 E_value: 3e-07
Swissprot: P80667|PEX13_YEAST
Gene Ontology:
GO:0005778 = Cellular component: peroxisomal membrane
GO:0030674 = Molecular function: protein binding, bridging
GO:0016560 = Biological process: protein import into peroxisome matrix, docking

Sequence:
>SY0AAB31YI13FM1
TTGGGATGGATCCTACAAAGTTGGAATTTTGCCGTGTCACGTTCGACTTT
ACACCGGAGCAGAATAACGGGGTTGAGTTAGAGGTCAAGAAGGGCGACTT
GGTTGCCGTCTTAAGCAAGGCAGATCCTATGGGTAACCCCTCGCAGTGGT
GGAAATGCCGGGCTAGGGATTCACGGGTTGGATACCTGCCGAGCCCGTAC
CTGGAGATTATCGCACGGAAAGAGGGAGCAGCCAAACAGATCACCGCAGG
GGATGAAAGTCGAACACAGACAATGACAAGTGAGATCGCAGGGGAATTGT
TGAAGGACACGAAGCCGGAGGACATTAGTATTGAGAGTTTTCAGAAAAGC
CAGTTTTTCTCATAGTTGCGACAAGGGTTTTTTTTTATTTTAGTGCAGGG
AGGAATAGAGGGTGTTTTTGTCATTTGGCTCTTTTCATGCCTGCCTCTCT
TTTCTCTTCGCGTTAATCTATTCCCTTTTCTTCCTTTCAATTTTTTTCTC
ATTCTCGTTCTCTTTTGCACGACAGCTTGGGCAGCGGCGGCACTATCACT
CGCTTCCTTATGTTCTCTAT

Sequences in the Contig:

SY0AAB31YI13FM1