Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YI07FM1
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00002791001 E-value : 1e-107
Numbers of ESTs : 1

Blast Results:

Nr Definition: 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase isoenzyme
Accession: ref|XP_001387456.1| Score: 204 E_value: 1e-14
KEGG Definition: ARO4; 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase isoenzyme [EC:2.5.1.54]; K01626 3-deoxy-7-phosphoheptulonate synthase
Accession: pic:PICST_80434 Score: 204 E_value: 6e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P79023|AROG_CANAL

Sequence:
>SY0AAB31YI07FM1
TTGGGACCATCATCTGTTACTCATCTTTTTCCCTTATTCCAGCTGATATA
CCGGTGCTCACTTTATCGATACGGTAGGTGACCTTGTACTCCTATCACTA
CTTCCAACCCCACCGCGCTTTCGCCTGGATTCTGGTGAGGTCTGTTTGCC
CCTTTGGTTTTATTTGATTTTCCGTGGTGTGCGGGGTGATCAGTTCATTA
AAGTTTGCTTGTGGGTGTTTGGAAATATTTTTTTTCCTTTTTCCTATCTA
CGGCATTCCTACGACCACTCCTACGACCACTTGGACCAAAGAAGACTAAC
GAGCCCGGGTACAAACCCGCATAGAAGAGAGGGTTTTTTTTCTAACAGAG
TGGTAGTCGATTTCGAACTCATATAAACCTCTTGATCTGCCTCTCTCTTC
TTGAAAGGAACACACCTTTTATTTTTTCATTCGACAAACCAATCCACCGC
AAACATGACTCCTAAAGCTGACGAGGTTGAAGACTCTCGCGTTCTCGGAC
AGGATCCTTTGATCCCTCCCAGTCTTTTGCAGCATGAGATTCCTTCTACA
CCCGAGTCTGAAGCTACTGTTCTCAAAGGTCGTCGTGATTCTATTGCGGT
GCTTGATGGAGTTTCCGACAAGCTTCTCGTCGTCGTTGGGCCATGCTCA

Sequences in the Contig:

SY0AAB31YI07FM1