Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YH24FM1
Length(NT) : 501
Best Gene Model Blast : Link to GSTUMT00005170001 E-value : 5e-62
Numbers of ESTs : 1

Blast Results:

Nr Definition: CALB_NEUCR Calcineurin B subunit (Protein phosphatase 2B regulatory subunit) (Calcineurin regulatory subunit)
Accession: ref|XP_387580.1| Score: 214 E_value: 4e-16
KEGG Definition: CALB_NEUCR Calcineurin B subunit (Protein phosphatase 2B regulatory subunit) (Calcineurin regulatory subunit)
Accession: fgr:FG07404.1 Score: 214 E_value: 2e-16
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0034 Score: 107 E_value: 4e-06
PFAM Definition: No Hit Found
Swissprot: P87072|CANB_NEUCR

Sequence:
>SY0AAB31YH24FM1
TTGGCTCTGCACTGTAGATTTACACGCCCAATAAACGCGAACTATCGCCC
CGTCACAACCACTTGTGACCTCCTACCCGCCGTCGGTACCTCTCTTCATC
CTATTCCTTCTCACCTTCAGCCCCCACCCCCGCCTCTGTGAGTAAACTCC
CCCCCTTCCCTGGTCTATCACTGCCAACCACCATCAACCTTTGCAATCCT
CCTATCTCCTTTCCTCAATAATTCATCCTCCTCATATCACCACTAGGAAA
TCACCATGGGGCAGAATCCTTCTCAGATTATGGACAACATTGTCTCCGGC
TCCAATTGTACTCGCCTCCCCCACTCAAAAGCAAACAGCAAGCATTTGCC
CCGTAGGTTTCACCGCTAACATAGTTACACAGTTGATCATGATGAAGTGG
ATCGATTGCGCAAGAGGTTCATGAAGCTGGATAAGGACAACTCCGGCACC
ATAGAGCGAGAGGAATTTCTGAGCCTACCGCAGGTCTCGTCAAACCCCCT
A

Sequences in the Contig:

SY0AAB31YH24FM1