Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YH16FM1
Length(NT) : 514
Best Gene Model Blast : Link to GSTUMT00011845001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SPAC1071.12c
Accession: ref|NP_001018265.1| Score: 390 E_value: 2e-36
KEGG Definition: stp1; hypothetical protein [EC:3.1.3.2]; K01078 acid phosphatase
Accession: spo:SPAC1071.12c Score: 390 E_value: 9e-37
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3217 Score: 387 E_value: 1e-38
PFAM Definition: LMWPc, Low molecular weight phosphotyrosine protein phosphatase..
Pfam Number: pfam01451 Score: 292 E_value: 1e-27
Swissprot: P41893|PPAL_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0051726 = Biological process: regulation of cell cycle

Sequence:
>SY0AAB31YH16FM1
TTGGGAACCGTGCTCCTCCAGAAACAAACAACCACCCCTATCGATCATTT
CCATATTCTTTGCCTCCAAACCCCGTGAACACTCTTTAACCTGTTCGTCC
ATCGAGGCTACCATTTGTCATGTCTAGCAGCAGAGTTGCAGTTGAGGATC
TTGACGCTGGCATGCATGCTGATGAGGATGCTATTAATGTTCTGTTTGTC
TGCCTTGGGAATATCTGTCGCTCCCCAATGGCCGAAGGAGCCTTCCGTAG
GACCGTTCAACAACTAGGCTTCAAAAACAAGTTCCGTAAAATAGACAGCT
GCGGAACGGCTTCTTATCATTCCGGAGAGCGCCCGGATCCTCGCACCGTT
CAACTTCTTGCTAAGCATGGAATTCATACGAGCCATCTAGCTCGTCAGCT
TGCTACCTCGGATTTCAATGATTTCGATTACATACTCCCTATGGATGATG
CAAACCTGCGTGATATAACCTCTGTCCAACCCGATGGTTCCAAGGCAAAA
GTCATGCTCTTTGG

Sequences in the Contig:

SY0AAB31YH16FM1