Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YH09FM1
Length(NT) : 565
Best Gene Model Blast : Link to GSTUMT00005939001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06991
Accession: ref|XP_001554403.1| Score: 255 E_value: 1e-20
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 246 E_value: 6e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB31YH09FM1
TTGGTCAGGCGGGAGAAAAACTCAATCGAGGACCTCGGAGATACTCCTTC
TGGATTCGAAAGGACGGTGAAAAATGTATGCGGGCTTTTCGTGCGGGTGA
TCGATTCGAAAATCTACCTCGTCCACCAAACCGCGAGGGAGTTTCTCATT
AAGGGATCTGTGGCTGGCCAGGGAAACTGGCAGTATACGCTATGTCTCAA
GGATTCTAACTTTGTAATGGCTGACATTTGTATTTCCTATCTCTCACTAG
AGGAGTTTAGTGGTTTCCCCTTAGCGATAGACATCGGCGGCAGGGTTTCA
GAGCATGCGGTTAAAGGTTATCTTGAGAAATACTATTTTCTGGATTACGC
AGCCCGACGCTGGGCAGATCACTTTCGTGATTCGCAGGATAAGGGGATGG
AGTTATTCGAGTTTACACGACGGATTTGTGGAGCTGGATCTAAACACTGT
CGGGCATGGTTTCAGTTGTACTGGTTCAACACCAGGTGGTATCTTATATT
CCCCAAAGATTTTACACATTTGATGATAGCATCTTTGCTTGGGCAGGGAA
CGGTAGTTGATCGAC

Sequences in the Contig:

SY0AAB31YH09FM1