Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YH05FM1
Length(NT) : 585
Best Gene Model Blast : Link to GSTUMT00008458001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10821
Accession: ref|XP_001550348.1| Score: 866 E_value: 2e-91
KEGG Definition: hypothetical protein
Accession: yli:YALI0E02046g Score: 830 E_value: 1e-87
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0162 Score: 900 E_value: 6e-98
PFAM Definition: Myosin_head, Myosin head (motor domain)..
Pfam Number: pfam00063 Score: 715 E_value: 1e-76
Swissprot: Q04439|MYO5_YEAST
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0000146 = Molecular function: microfilament motor activity
GO:0005515 = Molecular function: protein binding
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0006887 = Biological process: exocytosis
GO:0006898 = Biological process: receptor-mediated endocytosis
GO:0009651 = Biological process: response to salt stress

Sequence:
>SY0AAB31YH05FM1
GTCGGCGTAACTGATCTCACGCTAATATCCAAGATATCCAATGAAGCTAT
CAATGAAAATCTAAAGAAGCGATTCGAGAACCGCGAGATTTATACATATA
TCGGTCATGTGCTTATCTCTGTGAATCCTTTCCGGGATCTCGGAATCTAC
ACCGACCTGGTCCTAGCGAGCTACAGAGGGAAGAATCGGCTGGAGGTTCC
ACCGCATGTTTTTGCTGTCGCGGAGAGCGCCTATTATAATATGAATGGGT
ACAAGGAGAACCAATGTATCATCATTAGTGGTGAATCGGGAGCTGGAAAG
ACCGAAGCCGCCAAACGAATAATGCAGTATATCGCCGCGGCATCATCAAC
ATCTTCGACGACGATCCAAGAAATCAAAGATATGGTTTTAGCTACCAATC
CTCTTCTCGAGTCATTTGGGTGCGCGAAAACGTTAAGAAACAATAATTCT
AGTCGCCACGGAAAGTACTTGGAAATTCAATTCAATAGCCAAGGGGAACC
TGTCGGTGCGAATATCACAAACTATCTTCTTGAGAAGACAAGGGTTGTTG
AGCAAATTAGAGATGAGAGGAATTTCCACATCTTC

Sequences in the Contig:

SY0AAB31YH05FM1