Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YF16FM1
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00001336001 E-value : 2e-52
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG01960.1
Accession: ref|XP_382136.1| Score: 128 E_value: 3e-10
KEGG Definition: hypothetical protein
Accession: fgr:FG01960.1 Score: 128 E_value: 2e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB31YF16FM1
TTGGAACATCGACAACAACCACACAAGTTACGAACCACAAACGCAAAAAC
GAAAGCACTGCGAAAACATCTCCCAAAGAAAATCCTCAAAATGCCTTCCT
ATATCATAACCGTGAAGCCAGAGACCTCCGACTCGGAACTGCTAAAGATC
AAGGACGACATCGTCGCCCAAGGTGGGAAAATCACTCACGAGTATTCGCT
AATCAGGGGGTTCTCGTATGTTGCCTCCGCAGCCCACACTATCATTTGAG
CCAACCAGCTAACTGATCGATGTTTTACAGGTGCGAACTCCCTGTTAACC
AGGTTTCCACCTTGGAGACTCATAGACATGTGCAGAGCCTGGAGGTTGAT
GGCACGGTTACTACTCAGTAGTGGTAAGTTGTGCGCTTTTCGGTCCAGAC
AATGAATAAAGGACACACACATTTCCTACTCCAGATGGATAGTCGTCCGC
TGTGCATAATAATGTCGTGGGTGATACCGGTATGGGGTGGTTTTGCCACT
CGGTAGGGGTTGATTGTTTCACGTCTATTCTGTGTTCTATTCTATTTGAT
TTTTCTCTCCTGTCTCTTGCTCTGCGTTGCCCGT

Sequences in the Contig:

SY0AAB31YF16FM1