Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YC10FM1
Length(NT) : 629
Best Gene Model Blast : Link to GSTUMT00003552001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Alpha/beta hydrolase fold-3 domain protein
Accession: ref|YP_001361690.1| Score: 268 E_value: 4e-22
KEGG Definition: alpha/beta hydrolase fold-3 domain protein
Accession: kra:Krad_1940 Score: 268 E_value: 2e-22
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1515 Score: 250 E_value: 1e-22
PFAM Definition: Abhydrolase_3, alpha/beta hydrolase fold. This catalytic domain is found in a very wide range of enzymes..
Pfam Number: pfam07859 Score: 267 E_value: 2e-24
Swissprot: Q5UQ83|YR526_MIMIV

Sequence:
>SY0AAB31YC10FM1
TTGGGGTCAATTTCCAAGGAAAAGCCCACTCAATCATGAGGTTCACCATC
TTGTCCGTTCTCGCATTCTCGCTCCCTCTAGTCCTAGCGGAAACCCCCGC
TCCCTCCTGTCCAGTGACAAATGTGACCACTCCCCAGCTGGATCCCATCA
CCCAAGCCTACGCCGACGCAATCAGTAGCAGACCATCACTCTTCGCATTT
CCACTTCCCGAGATACGTGATGGGTACCAGAGCAACGTATCAGACCCTTC
AACTGAGTTCACTACCAAAATCCTCTCCCTCCCCGTTGGCCCGACTGGTA
ATGTCACTGCTTACCTCTACAAACCGGTATCCGGCGAGAGGGAGAAGGGG
AAGGACTTGTTGCCCGTTATCGCTTACTTTCATGGCGGCGGTTGGGTCTT
CGGAGGCCCGAAGAGTTACCGGGGGCTCATCACTAACCTGATTCGTGAGT
CGGGTGCTGCTGTATTCTTTGTTGATTACACGCTCACTCCCAAGGTGGCG
TATCCGGTCCCGAATGAGCAGTGTTATGCCGCTGTGCAATGGTTGCTGGA
GCATGGCGAAAAGCTCGGCGTTGACCCGACGAATATGGGCTTTGGTGGGG
ATAGTGCTGGTGGGGAACTCTCATCGTCC

Sequences in the Contig:

SY0AAB31YC10FM1