Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YB14FM1
Length(NT) : 590
Best Gene Model Blast : Link to GSTUMT00004550001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 433 E_value: 3e-41
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 378 E_value: 3e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 239 E_value: 2e-21
PFAM Definition: No Hit Found
Swissprot: Q71S22|INVSA_XENLA

Sequence:
>SY0AAB31YB14FM1
TTGGTGATGCCAATCCCAACTTAGCGGACACGGAGTGTAATCGAACACCG
CTTTTGTGGGCTGCTAAGAATGGGCATGAAGAAGTCGTGAGGATGCTCCT
TCTACGGAACGACATCAATCCCGACACAGTGGACACCCGGTATGGCCGAA
CACCACTCATGTGGGCTGTTGTGAGCGGGTATGAGAGGATCGTGAAGATG
TTGCTGCAACGGAACGATGTGATCCCCGGCACATCTGACACCAGGGGCCG
CACACCGCTCTCATGGGCTGCCAAGAATGGGGACCGGAAGATCGTGGAGA
TTTTGCTGGAACAGAACGCCGTAAATCCCAACACAGCTGACTCCGAGTAT
GGCCGAACACCGCTCTCGTGGGCTGCTGAGAATGGGCACGAGGGGGTCGT
GAGGGCACTGTTGCGGCGTAGTGACGCCAATCCTAACACAGCTGACGCCA
AGCATGGCCGAACACCACTCTTGTGGGCTGCTAAGAATGGGCATAAGGGA
GTAGTGAGGGCATTGCTGGGCTGGAGTGACATCAACCCCAACACAGCTGA
AACCAAGTATGGCAGAACCTCGCTCTTGTGGGCTGCTAAG

Sequences in the Contig:

SY0AAB31YB14FM1