Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YA19FM1
Length(NT) : 502
Best Gene Model Blast : Link to GSTUMT00010364001 E-value : 2e-83
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001208385.1| Score: 169 E_value: 7e-11
KEGG Definition: predicted protein
Accession: aor:AO090023000046 Score: 155 E_value: 1e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB31YA19FM1
TTGGGGTTTTTGCGGTTTCGTTATTCGGTCTTGGTTGGTGTGAATTGATC
GAACCTTGAAGCGCGTGAGAGTGAGAGTGAAATTTTCGAGATATGGGTTC
GGGAGGAGGAGTGGGTCCGCTCTTCCTGGCGGTTATGTATACACTATTGG
CGTTATCGACGGTATTTATGGCGTTAAGGTTTTACTGTCGGGCGTTTATT
ATTAAGATGGTCAGATCGGATGATTGGATCATGCTTGCTGCTTTCATAGG
TGCCTGGGGGTTAGGTATAACGAATGCTTTTCATATAAAATACGGCATCG
GATCTCATTTAGATGACCCACGAAAGTATCAAGTAGTGATCGTTCCAATG
CTTAAACTCTGGTACGTCTACCAGCTGCAATACCTCGTCACCCTATTTTT
CATCAAAGCCAGCATCCTCTCCTTCTACCGGCGCCTCTCCCGCGAGAGAA
CCTACCAGATTTCGATATGGATCGTTAGCGGCATTGTCGTGGTGTTCACC
CT

Sequences in the Contig:

SY0AAB31YA19FM1