Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB31YA07FM1
Length(NT) : 634
Best Gene Model Blast : Link to GSTUMT00000156001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001273743.1| Score: 249 E_value: 9e-35
KEGG Definition: hypothetical protein
Accession: fgr:FG00201.1 Score: 190 E_value: 2e-30
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB31YA07FM1
TTGGGCATTCGCAGCCTTGCGGGCTCGAGACAGTGGTCGTAGAGGTGGAC
CCGATCCCGTGCTGGTAGAGGGGTGGACCTTGTACGCTCTGGGCGTATCC
GTAATTCTAGCCCGCTTGGTAACACGGTACAAGATGGTGGGCGTGGAAGG
CAGCAAACCGGATGACTGGTTAATGATTCTGGTTATGATTATCTACGGGA
TCGAATCCACCATGTCACATCTAGTCAGTCTCTATGGCGGGAATTCCAAT
CTCTCGCCAGCGCAACGAGCGGGGATGAGTGAGGAGGAGGTGCAGAGGAG
AGTATTTGGGTCGAAAATGTTTATGGTTGGGTGGTTCTCTTACAGTGGTG
CCATGTGGGTGTTGAAGCTGTGCATGGTTTTCTTTTTTGCTAGAATAACG
GTTGAGAAGGCAGGTTTGGATCACAACAGCTTACGTTGTCGTGGGCATGT
CTTATTTTGTCATATGTCTCGTGCTGTTCCTGACCTGTCGACCCTGGCAC
AAACTCTGGCAGATATATCCAGACCCGGGATCGAACTGCAGCATCGAATC
TCCAGTATATTACCTCACCGTCCTATCCTTCAACGTCCTCACCGATGCCT
TTCTTATATCGCTTCCATTGCCACTATTGATCCG

Sequences in the Contig:

SY0AAB31YA07FM1