Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YO22FM1
Length(NT) : 598
Best Gene Model Blast : Link to GSTUMT00011939001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_03630
Accession: ref|XP_001794185.1| Score: 368 E_value: 9e-34
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB30YO22FM1
TTGGCAGGCTTGCTGGAACATATCCTCCCCGAGGAAGAAAAAATGCTTCG
TACAACTAGCATGCGAACACTCCAATGCGTCGTGAAGCACAAGCTAATGG
ATGTTGATGCCGACCTTCGTCTGGTCAGGGTAACGCCCTCTCAAAACCCC
TTATCCTGCGAAAAAGGCTGGTTCTGCCCCTACCTCTTCGCCAGTTCCCG
TACACCTATAATCCCACGCTCGCAGGACTTCGCCATTGCACAATGCTTCG
GCCCCTTCTTGGCAGGTGACTACCAGTTGGCACACAAACTTCTTTCCGAG
TCTGCTGCGGTGCTCTCCCTTTGCAACCCCGACCCCACTGTCAACATTGG
CGTCAACCGTATACTCGTAACGTTCATTGGTATCACACCATACAGAGGCG
GTATTTGGTCTTCTTCCCGAAGACCTGGTGCTGCGCTTATGAATTTTCAC
CTACTAAATGGGTGTCCTTCTATGGTTATCCCTGTGAATAATATGGCGCC
GATTGTAGCATGGAATCCTACTACGCTGGCCAGTATCAAGAATCCGGGCT
TCAATCCGGAGTGGTTGCATGAACAGATATGTGAATTTTTGGACACAA

Sequences in the Contig:

SY0AAB30YO22FM1