Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YO21FM1
Length(NT) : 602
Best Gene Model Blast : Link to GSTUMT00010662001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An09g02800
Accession: ref|XP_001393594.1| Score: 297 E_value: 2e-25
KEGG Definition: hypothetical protein
Accession: ang:An09g02800 Score: 297 E_value: 8e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB30YO21FM1
TTGGGCAAATGCCTTCCTGCGAATCGACATTTTACTCCTCCTCATCCTCT
TCTGTCTCTGCGCCTCGCACGCTCATCGTCCTATTTATCATGGCGTTAGG
GTTACCATCGATTATCAGTTCTTATTACCGCCATACTAACTCCTACTCCG
GCCCGGCTCCAGCATATATCGGGTTCGGCTTCCGCCTGGGGCTTCTCCTT
AGTGCGTTGTATTGGGCTCTTGACTCTGCCGATAATGGGGACTGGATCCC
AGATCTCCCCGAGGGGGTATTGAAACCGCTGAAGAACACCGTTAGCCAAA
TCGTCCTAGCGATGGGCCTCCTCGCTGGGAACCTGGTATACGCATACTCT
TCCGTATGTGTGGCCGTCCGTTTTGAATATCCACTCGCCAACCAACCCAC
CACCTCCTCCGATGGTGACGGTGAAGACATAGTCCCCCCCTCCCAGAGCT
TAAAACCCATCGCCCGCATCGTTGGCACGTCAAACTTGCACGGATCCCGC
TACTTTATGCTGCTACTATCCTGGTCCCTGGCCCTAATCCTCCTTCAAAA
GCCCATGGGCGGTGCGTCAATGGGTCTCCTCCTGTGGCAAATCCTCTCCC
TG

Sequences in the Contig:

SY0AAB30YO21FM1