Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YO15FM1
Length(NT) : 666
Best Gene Model Blast : Link to GSTUMT00000204001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_00051
Accession: ref|XP_001790748.1| Score: 733 E_value: 6e-76
KEGG Definition: hypothetical protein
Accession: fgr:FG00776.1 Score: 729 E_value: 8e-76
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG2056 Score: 500 E_value: 2e-51
PFAM Definition: ENTH, ENTH domain. The ENTH (Epsin N-terminal homology) domain is found in proteins involved in endocytosis and cytoskeletal machinery. The function of the ENTH domain is unknown..
Pfam Number: pfam01417 Score: 423 E_value: 2e-42
Swissprot: P78813|YCTB_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>SY0AAB30YO15FM1
TTGGATTGCTCAAGTCCACGACATCTTTATCATACAAATTTGTTTTTTTC
TTTTCCCTTAAAATCCGTTCAACCACAGACTCCTTTTCACATATTCACAC
AAACACACACACACACGCACACGCACGCACCTCTTGGAGCGCATTCCTCT
GCCCATAATGAATCTTGATAATCTTCGCGACGTCGTTCAGAATATTTCTT
TGTACGATGTCAAGGCAGCCGTTCGAAAGGCTCAAAATGTCGTCATGAAT
TACACTGAGATGGAAGCGAAGGTGCGGGAGGCAACAAACAATGAACCATG
GGGTGCATCGTCTACACTTATGCAAGAGATAGCAAATGGGACATTTAACT
ACCAACTCCTGAACGAGATTATGCCCATGGTCTACAAACGATTTACAGAA
AAGTCTGCTGAAGAATGGAGGCAGATTTACAAGTCTCTTCAACTCCTTGA
ATTCCTTGTCAAGAATGGCTCAGAACAGGTTATCGACGATGCTCGCTCCC
ACCTCTCGACTATCAAGATGTTGCGCCAATTCCACTTTATCGATATGGCG
GGCAAAGATCAGGGGATTAATGTCCGTAACCGTGCTAAAGAACTTGCCGA
CCTCCTTTCCGATGTTGAAAGAATCCGTACCGAGCGTAAGAAAGCGCGTA
GCAATAAGAACAAATA

Sequences in the Contig:

SY0AAB30YO15FM1