Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YK01FM1
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00008619001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG10849.1
Accession: ref|XP_391025.1| Score: 273 E_value: 4e-30
KEGG Definition: hypothetical protein
Accession: fgr:FG10849.1 Score: 273 E_value: 2e-30
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1666 Score: 191 E_value: 1e-15
PFAM Definition: V-SNARE, Vesicle transport v-SNARE protein. V-SNARE proteins are required for protein traffic between eukaryotic organelles. The v-SNAREs on transport vesicles interact with t-SNAREs on target membranes in order to facilitate this..
Pfam Number: pfam05008 Score: 133 E_value: 5e-09
Swissprot: P78768|VTI1_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0005773 = Cellular component: vacuole
GO:0048278 = Biological process: vesicle docking

Sequence:
>SY0AAB30YK01FM1
TTGGCCCCACACTCAGCCCTCTAGCTACAAGCTTTAAGATATCATACCAA
GTAAATTCTCAGGAGCTTACCGGCGCTCCTCATCTATCCCCGACATCACC
GGAGTTGAGCTAGAGGAGTCAACCCATCTACCCTTCGATACTAACCGTCA
CCGCCCCTACCAGATAGGTCATAAGCATGTCGAACACACTCGATTCTGAT
CCCGGCTCGGAGCTCTTCGCCTCATACGAGGCCGATTTCAAGCTTGTCCG
AGCAGATATCTCTCAAAAGCTCGATCAAATACCTGAGCTTTCCGGGGAGC
CGCGCAAGGCGGCTATTCGTGCTGCCGAAAGGGCCGTTGATGAGGCCGAT
GAAATTCTCGGTCAAATGTCCCTAGAGATCAATAATATCCCCTCCGCCCA
GAGACCCAAGGTTAAATCCCGTCTCCGCAACTATACCCATGACCTCGATA
CCTCCCGCCACTCGCTTGTCAAACACGCTCAAAACTTCGACCGTGATGCT
CTCTTTGGAGCTCGCTCGAAACCCGGCGACTTAGAGATTCGCAACGTGTC
GCAAACGAAACTGAAGAAATCGGTGCTTCCATTTTAGGCGATCTTGGGAG
ACAGAGGGAACAGATCATGAATACCCATAACACCCTGA

Sequences in the Contig:

SY0AAB30YK01FM1