Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YJ12FM1
Length(NT) : 458
Best Gene Model Blast : Link to GSTUMT00006599001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 352 E_value: 4e-32
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 346 E_value: 8e-32
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 251 E_value: 6e-23
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAB30YJ12FM1
TTGGTCAGAATGGTCGCACAATATTCTCGTTTGCTTCTGAGTTTGGGAAT
GAACATATAGTCAGGCTACTTCTGGAACGCTGGAAGGTCAACCCCGACTC
CTTAGATTGCGAGGGTCGAACACCCTTATCATTCGCTGCCTCAAGAGGAC
ATGGGGGTGTAGTTAAGCTACTTTTGGAATGTGGGAAGGTCAATCCGGAT
CCACCAGATAGCTGTGGTCGAACACCCTTATCATACGCTGCCGAGCAGGG
GGCCCAAAGTGTCGTGAAGCTACTTCTTGAACGCGGGGATGTTAATCCCG
ATTTACCGGATACCATTGGCTGCACACCCCTATCATATGCAGCCTGGAAG
GGAGAGGAAGCTATAGTGATGTTACTCCTGGACCGCAAGGGTGTCAATCC
CAATTTGCCAGATAACGAGGGTCGAACACCGCTATGTTACGCTGCCGATC
AGGGGGCA

Sequences in the Contig:

SY0AAB30YJ12FM1