Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YI11FM1
Length(NT) : 587
Best Gene Model Blast : Link to GSTUMT00009704001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_04733
Accession: ref|XP_001557017.1| Score: 246 E_value: 3e-38
KEGG Definition: predicted protein
Accession: aor:AO090005000783 Score: 234 E_value: 2e-38
KOG Definition: No Hit Found
PFAM Definition: SPB_interacting, Spindle pole body interacting protein. Yeast YOR129C has been shown to interact with the outer plaque of the spindle pole body..
Pfam Number: pfam08616 Score: 198 E_value: 1e-16

Sequence:
>SY0AAB30YI11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCAGCTCTTTACTGCTGTAAATAGTATGGACCTTTCGCCGATGC
CGCGTTTGTCAATATTCGAACGTCAGGTCCTCGCTGCAAGTGATAAGAAA
GAAATGTTTTCTGAGAAATTTGACGAAATGGCAATGGCCTCGCCAAACGC
CGTGGTTCACCAAATGAGGTCGCCATCGGCCGCTGGCATGATCACAGCTA
GTGACCAGGATGGTGATTTAAGACCGACTACATATATCGATCTGGCACCT
GGCAGGAACAAGATTGTGAATGGAAAAATCACTATTAATCGAGATAGCCA
TGAGTTTGAAACGAAAGTTGTTTATAACGGCATACCTGTGCCTATAAGGG
TTCCGGTAGCTGTTTTACCAGAGACTGGTCGGTGATTTCTCGTTGATACA
ACTCATTACCACATTTTCGAACCCTCATTCCCAGAACCCCCAGCCGTTCG
CGCTTCATCCGCACCTCACAACGAATGGCCCATACACACATCCCATAATG
GTTCTGGTTAATGGACTACTCACACAAAAGAGAATTG

Sequences in the Contig:

SY0AAB30YI11FM1