Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YH06FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00011893001 E-value : 8e-89
Numbers of ESTs : 1

Blast Results:

Nr Definition: HS30_EMENI 30 KD HEAT SHOCK PROTEIN
Accession: ref|XP_661159.1| Score: 177 E_value: 1e-11
KEGG Definition: 30 kD heat shock protein
Accession: ani:AN3555.2 Score: 177 E_value: 6e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P40920|HSP30_EMENI

Sequence:
>SY0AAB30YH06FM1
TTGGAGACACTCCTCGTCCGCGGCAAGACCGAACGCCTTCACCAGGAGTC
CTCGGACAACGAACCCGCCATCGCCAAGAAAGACAAAAAAGAGGTCCAGC
AAGAAGCCAAGGGTGCCATCGAGGAGAAGGATAAAGATTCCAGGCCCCGC
TATTGGGTTTCGGAGCGCACGGTCGGCGAGTTCCAACGCAGCTTCTCGTT
CCCGAGTTATGTGGATATGGACGCCGTGAAGGCTAGTCTTGCTTTTCTTT
TCTTTTTCTTCCCCATTTCATTCCCTCCTTTCCCTCCCGCTGATGATTCC
CGGGAGTATTACGACCCACAGGCATTTATATCTGCTGCACCTTTGGCTTT
TTGGGGTTTAGCAAAAGACCCAATTAGCGCAGGATACATTCAGGAAATCG
GTCATTAATGATTCTCCTTGGTTGTCTCTCTTTTACCCGTCTTTGGCTGC
CTTCTTTGCTTTCCCCCACAAAATCCTCCCGGCACTACACAAAATTCCCC
TATCTGTTTGCACGCATGCATTGTGATTCTTCAATGTCTCTCATGCCCTG
TCACTCTTTCCAACCCGCTAC

Sequences in the Contig:

SY0AAB30YH06FM1