Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YF06FM1
Length(NT) : 483
Best Gene Model Blast : Link to GSTUMT00004542001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_500433.1| Score: 498 E_value: 4e-49
KEGG Definition: hypothetical protein
Accession: yli:YALI0B02684g Score: 498 E_value: 2e-49
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0207 Score: 297 E_value: 3e-28
PFAM Definition: E1-E2_ATPase, E1-E2 ATPase..
Pfam Number: pfam00122 Score: 160 E_value: 2e-12
Swissprot: Q9S7J8|AHM5_ARATH

Sequence:
>SY0AAB30YF06FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTGCTGTCACAACATGGGTTGTCTGGCTTGGATTAGGTATATC
AGGCCGCCTTCCTGACTACTACCTGGATGTTGACCATGGAGGGTGGGCTG
TTTGGTCCCTCGGATTTGCCATCGCTGTATTTGTCATCGCTTGTCCTTGT
GGGATCGGCCTTGCGGCGCCAACTGCTTTATTCGTTGGCTCCGGGTTAGC
GGCGAAGTTTGGTATTCTGGCGAAAGGTGGCGGCGAGGCCTTTCAGGAGG
CTTCATGGTTGGACTGTATTGTTTTTGATAAGACTGGAACATTGACTCAG
GGTGGCGAACCAAAGGTTACGGATGAGAGGATACTCGTTGAGGGTAGCGA
AGCTAGGGAGATTGCATACGCTATTGCGCACAAGCTAGAGGGGGGATCTG
CACATCCACTTGCTATAGCTGTGATCGCGCATT

Sequences in the Contig:

SY0AAB30YF06FM1