Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YC12FM1
Length(NT) : 723
Best Gene Model Blast : Link to GSTUMT00006797001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06709
Accession: ref|XP_001554921.1| Score: 565 E_value: 5e-99
KEGG Definition: ubiquitin-protein ligase E3 component (UBR1), putative [EC:6.3.2.19]; K10625 E3 ubiquitin-protein ligase UBR1
Accession: afm:AFUA_6G08420 Score: 529 E_value: 2e-88
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1140 Score: 197 E_value: 2e-16
PFAM Definition: No Hit Found
Swissprot: O60152|UBR1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0004842 = Molecular function: ubiquitin-protein ligase activity
GO:0043161 = Biological process: proteasomal ubiquitin-dependent protein catabolic process
GO:0031144 = Biological process: proteasome localization
GO:0016567 = Biological process: protein ubiquitination

Sequence:
>SY0AAB30YC12FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAGCCGGGTATGCCAACAA
ACACCCTGTCCCTCCTCACGAAGACCTACGCCAAAGGGTCCGACTGGACT
GGCTCATCCTTTTTGACCTGAGACTTTGGAAAAAGGCTAGGATTGATCTG
CGGGATCTTTATATTAGCACTGTGGTCGCTATTCCCGAGTTCAAGCGAAT
TCTGGGTTTACGGTTCTCCGGTCTATACACTGTTCTGAGTCAATTGTACC
TTGTTCCCGACCGGGAGCCTGACCACTCTATTATCAACCTTTCCTTGCAG
ATTCTAACAACGCCCTCCATAACCGCCGAGGTCGTCAAGCGTGGGAACTT
CTTAACAAATCAATTGGCCATCCTGTATACCTTTCTCACCACTCGCCAAG
TAGGTCATCCCCATGAAGTCAACCAAGAGGCAACTCTTGGCATTTGATAC
AGGATCTCTCACCAATCGGAGAATGTTCCATTTCTTCCATGATATGCGGT
ATTTGTTCGCATCCGATTATGTCCAGGATAGATTACGGCATGAGGAGAGA
TATATGCTTCAATTTCTAGATCTAGTAACCCTTCACCAAGGCATTTGCCC
CAACACCCGCGCAGTTGGTGAGCATGTAGAGTACGAAGCCGAGGCGTGGA
TCAGCGCATCCTTGATTACGCGAGAGATCAATAGATTGGTTAGGCAGTTC
TCGGAAGCGTACCGATGGACCGA

Sequences in the Contig:

SY0AAB30YC12FM1