Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB30YB19FM1
Length(NT) : 581
Best Gene Model Blast : Link to GSTUMT00007951001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05051
Accession: ref|XP_001593623.1| Score: 652 E_value: 1e-66
KEGG Definition: hypothetical protein
Accession: fgr:FG08785.1 Score: 646 E_value: 3e-66
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0781 Score: 557 E_value: 3e-58
PFAM Definition: SRP54, SRP54-type protein, GTPase domain. This family includes relatives of the G-domain of the SRP54 family of proteins..
Pfam Number: pfam00448 Score: 332 E_value: 4e-32
Swissprot: P32916|SRPR_YEAST
Gene Ontology:
GO:0005785 = Cellular component: signal recognition particle receptor complex
GO:0005525 = Molecular function: GTP binding
GO:0005515 = Molecular function: protein binding
GO:0005047 = Molecular function: signal recognition particle binding
GO:0006614 = Biological process: SRP-dependent cotranslational protein targeting to membrane

Sequence:
>SY0AAB30YB19FM1
TTGGAAAAGAACTCACAGAGCGCGAGGGGGGTGTTGTCGAACTCTACGAA
AAGGGCTACGGGAAAGATGCAGCCAACATTGCCAAAGACGCGGTCGCCCA
TGGCGGAGCAGAAGGGTACGATGTTGTGCTTATCGACACCGCTGGAAGAA
GACACAATGATCAGAGACTCATGAGCAGTTTGGAGAAGTTTGCCAAATTT
GCCAATCCGGATAAGATACTCATGGTCGGGGAGGCGCTCGTGGGAACCGA
TTCAGTCCTTCAGGCGAGGAATTTCAATGCTGCATTTGGGAGCGACAGGT
CGCTGGATGGGTTCATTATTAGTAAATGCGATACTGTTGGTGATATGATC
GGAACCCTGATTAGCATGGTCTTCGCGACCGGAATTCCGGTGCAATTTCT
AGGCGTTGGTCAGAATTATCAGGATCTTAGGACTTTGAACGTTTCTTGGG
CTGTCAAGTTACTCATGTCTTGAATTTGTTTCAGGTTTTTTTTTGTTGTC
GGTGGGAGTTTATGCCGGGTTGGCTCTGAATGCAGTTAGGATATGAATAT
GTTAATCGTAGTTTCTCCGGACTTTTCCTTT

Sequences in the Contig:

SY0AAB30YB19FM1